Cloning
1. PCR Reaction (Invitrogen Pfx polymerase)
|
(µl) |
|
|
10 ×PCR Buffer |
2.5 |
|
MgCl2 (50mM) |
0.5 |
|
dNTPs (10mM) |
0.8 |
|
Primer F ( 10µM) |
0.5 |
|
Primer R ( 10µM) |
0.5 |
|
Template( 10ng/µl) |
1 |
|
Pfx polymerase |
0.2 |
|
ddH2O |
19 |
|
Total |
25 |
Step 1: 94oC, 2min
Step 2: 94oC, 15 sec
Step 3: 55oC, 30 sec
Step 4: 68oC, 1kb/min
Step 5: Repeat steps 2-4 for 36 cycles
Step 6: 68oC, 10 min.
We usually run a gel to confirm that PCR is OK.
2. PCR Purification
We usually use ZYMO DNA Clean & Concentrator™-5 Kit to purify DNA from PCR. (Catalog # : D40030)
3. Restriction digest (For double digest)
|
For PCR product (µl) |
For Vector (µl) |
||
|
10 × Buffer |
3 |
10 × Buffer |
2 |
|
100 ×BSA |
0.3 |
100 ×BSA |
0.2 |
|
Enzyme 1 |
0.8 |
Enzyme 1 |
1 |
|
Enzyme 2 |
0.8 |
Enzyme 2 |
1 |
|
PCR product |
25 |
Vector |
1.2~1.5 µg |
|
ddH2O |
Add to 20 |
||
|
Total |
30 |
Total |
20 |
We usually digest overnight.
4 Purification
For Vector: run 1% agarose gel, conduct gel purification using ZYMO Zymoclean™ Gel DNA Recovery Kit. (Catalog #: D4001)
For PCR product: follow step 2.
5 Ligation
Run the vector and insert (1µl each) on an agarose gel, and estimate the amount of the vector and insert.in one ligation tube, add 3~5 fold of insert usually.
|
(µl) |
|
|
10 ×T4 DNA ligase buffer |
1.5 |
|
T4 DNA ligase |
1.0 |
|
Vector |
X µl |
|
Insert |
X µl |
|
ddH2O |
Add to 15 |
|
Total |
15 |
incubate either 14 or 16 degrees overnight; room temperature (22 degrees) 2~4 hours.
7 Transformation
7.1 Take 50 µl DH5a competent cells from –80 ºC freezer, and incubate on ice to thaw.
7.2 add ligation product to the competent cell and mix gently. Do not mix by pipetting up and down.
7.3 Incubate the cells on ice for 30 minutes.
7.4 Heat-shock the cells for 30 seconds at 42°C without shaking.
7.5 Remove the vials from the 42°C water bath and place them on ice for 2 minutes.
7.6 Add 250 μl of room temperature S.O.C. Medium to each tube.
7.7 Cap the vials tightly and shake horizontally at 37°C for 1 hour at 225 rpm in a shaking incubator.
7.8 Spread on a pre-warmed selective plate.
7.9 Incubate plates overnight at 37ºC.
8. Pick up the colonies and analyze the colonies (digest)
|
(µl) |
|
|
10 × Buffer |
1 |
|
100 ×BSA |
0.1 |
|
Enzyme 1 |
0.5 |
|
Enzyme 2 |
0.5 |
|
plasmid |
200~500 ng |
|
ddH2O |
Add to 10 |
|
Total |
10 |
Incubate at 37 ºC for at least 1.5 hours. Then run 1% agarose gel.
9. LR Reaction
|
(µl) |
|
|
Entry clone |
120 ng |
|
Destination vector (Gateway Box) |
150 ng |
|
ddH2O |
To 8 |
|
Total |
8 |
Then add 2 µl LR Clonase II enzyme mix to the reaction, and mix well. Incubate reactions at RT for at least 1 hour ( or several hours or overnight).
Before transformation, add 1 µl proteinase K to the reaction, and mix well. Incubate at 37 ºC for 10 min.
Transformation: Take 10µl TOP10 competent cell from –80 ºC freezer, and incubate on ice to thaw. Add 2 µl LR reaction product to competent cell, then follow step 7.
10. Identification of LR colony
Pick up the colonies, miniprep, and then send out for sequencing.
The sequence of primers for sequencing as following:
- PENTR1a-seq-F: CTACAAACTCTTCCTGTTAGTTA
- PENTR-seq-R: GTAACATCAGAGATTTTGAGACAC
- PT3EF-1aH-seq-F: GAGTTTGGATCTTGGTTCATTC
- PT3EF-1aH-seq-R: TAGAAGGCACAGTCGAGG

